How to make a primer

Design of Primers for Automated Sequencing

One of the most important factors in successful automated DNA sequencing is proper primer design. This document describes the steps involved in this process and the major pitfalls to avoid.

**** Use a Computer to Design Primers ****

We highly recommend that a computer be used during primer design in order to check for certain fatal design flaws. Numerous programs are capable of performing this analysis. For example, look for ‘Primer3’ on the web.

Some Basic Concepts: If you are confused by the strands and primer orientation, read this.

Sequencing primers must be able to anneal to the target DNA in a predictable location and on a predictable strand. They furthermore must be capable of extension by Taq DNA Polymerase.

Some people are confused about how to examine a DNA sequence to choose an appropriate primer sequence. Here are a few things for novices to remember:

Here are a couple of examples:

Suppose you have a vector with the following sequence around the Multiple Cloning Site (the ‘MCS’):

If you cloned your DNA of interest between the BamHI and EcoRI sites, you could sequence using the primer ‘CTTGATGCTAGTACTACATC’ (remember – that’s written 5′ to 3′) and you’ll obtain the following sequence from the Core:

What if you wanted sequence from the other strand – Eco to Bam – instead? In that case, you need to select some sequence on the right and then reverse-complement it before requesting the oligo. Picking out some sequence from the figure above:

This is NOT the primer sequence – it is copied verbatim from the above sequence. In fact, if you used this sequence for a primer, sequencing would proceed towards the right, away from your insert. Instead, reverse-complement that sequence:

NOW this should produce the sequence of the opposite strand:

Some fine print: Only rarely does sequencing actually show the nucleotides immediately downstream from the primer. I’ve taken some didactic license in the examples above.

More Advanced Concepts: How to Design a Primer that Works.

Generally, you are starting with some small amount of known sequence that you wish to extend. Here’s how to proceed:

I. Design primers only from accurate sequence data. Automated sequencing (and in fact any sequencing) has a finite probability of producing errors. The sequence obtained too far away from the primer must be considered questionable. To determine what is ‘too far’, we strongly suggest that our clients read the memo Interpretation of Sequencing Chromatograms, which describes how to assess the validity of data obtained from the ABI sequencers. Select a region for primer placement where the possibility of sequence error is low. II. Restrict your search to regions that best reflect your goals.

You may be interested in maximizing the sequence data obtained, or you may only need to examine the sequence at a very specific location in the template. Such needs dictate very different primer placements.

  1. Maximize sequence obtained while minimizing the potential for errors:
    Generally, you should design the primer as far to the 3′ as you can manage so long as you have confidence in the accuracy of the sequence from which the primer is drawn. Primers on opposite strands should be placed in a staggered fashion as much as possible.
  2. Targetted sequencing of a specific region:
    Position the primer so the desired sequence falls in the most accurate region of the chromatogram. Sequence data is often most accurate about 80-150 nucleotides away from the primer. Do not count on seeing good sequence less than 50 nucleotides away from the primer or more than 300 nt away (although we often get sequence starting immediately after the primer, and we often return 700 nt of accurate sequence).

III. Locate candidate primers:

Identify potential sequencing primers that produce stable base pairing with the template DNA under conditions appropriate for cycle sequencing. It is strongly suggested that you use a computer at this step. Suggested primer characteristics:

  1. Length should be between 18 and 30 nt, with optimal being 20-25 nt. (Although we have had some successes with primers longer than 30 and shorter than 18).
  2. G-C content of 40-60% is desirable.
  3. The Tm should be between 55 C and 75 C. Warning: the old “4 degrees for each G-C, 2 degrees for each A-T” rule works poorly, especially for oligos shorter than 20 or longer than 25 nt. Instead, try:

Primers that can self-hybridize will be unavailable for hybridization to the template. Generally avoid primers that can form 4 or more consecutive bonds with itself, or 8 or more bonds total. Example of a marginally problematic primer:

This oligo forms a substantially stable dimer with itself, with four consecutive bonds at two places and a total of eight inter-strand bonds.

Primers with 3′ ends hybridizing even transiently will become extended due to polymerase action, thus ruining the primer and generating false bands. Be somewhat more stringent in avoiding 3′ dimers. For example, the following primer self-dimerizes with a perfect 3′ hybridization on itself:

The above oligo is pretty bad, and almost guaranteed to cause problems. Note that the polymerase will extend the 3′ end during the sequencing reaction, giving very strong sequence ACTATGC. These bands will appear at the start of your ‘real’ data as immense peaks, occluding the correct sequence. Most primer design programs will correctly spot such self-dimerizing primers and will warn you to avoid them.

Note however that no computer program or rule-of-thumb assessment can accurately predict either success or failure of a primer. A primer that seems marginal may perform well, while another that appears to be flawless may not work at all. Avoid obvious problems, design the best primers you can, but in a pinch if you have few options, just try a few candidate primers, regardless of potential flaws.

V. Verify the site-specificity of the primer. Perform a sequence homology search (e.g. dot-plot homology comparison) through all known template sequence to check for alternative priming sites. Discard any primers that display ‘significant’ tendency to bind to such sites. We can provide only rough guidelines as to what is ‘significant’. Avoid primers where alternative sites are present with (1) more than 90% homology to the primary site or (2) more than 7 consecutive homologous nucleotides at the 3′ end or (3) abundance greater than 5-fold higher than the intended priming site. VI. Choosing among candidate primers.

If at this point you have several candidate primers, you might select one or a few that are more A-T rich at the 3′ end. These tend to be slightly more specific in action, according to some investigators. You may want to use more than one primer, maximizing the likelihood of success.

If you have no candidates that survived the criteria above, then you may be forced to relax the stringency of the selection requirements. Ultimately, the test of a good primer is only in its use, and cannot be accurately predicted by these simplistic rules-of-thumb.

With luck, though, you have plenty of options for primers. For a sequence assembly project, design more primers than you think you really need so that if the sequence isn’t as long as you hoped, you might still obtain sufficient overlapping data to assure you of a good sequence consensus. We recommend that you sequence both strands, for better confirmation. On one strand, space the primers 500 to 700 nt part (shorter spacing is safer!). On the opposite strand, place the primers in staggered fashion away from the first strand primers, as depicted below:

This post may contain affiliate links.

How to make a primer

How to make a primer

Enjoy these two recipes for a DIY makeup primer. It is simple, inexpensive, and effective to make a DIY face primer at home. You can do this and you should!

Even though I don’t get out as much these days, I still need to run to the grocery store once in a while. My skin tone is naturally uneven, so I do use a bit of powdered make up. I have really oily skin so I usually use a primer of some sort, but not being able to shop for one is difficult. So, I made my own!

DIY Makeup Primer

The easiest way to make a homemade makeup primer for your face is to mix 3 parts of a gel to one part of a powder. While there are several of each to choose from, I made it simple.

Ingredients

  • 1 Tablespoon aloe vera gel
  • 1 teaspoon arrowroot powder

Instructions

  1. Mix the two of these thoroughly and spoon into a wide mouth jar. That’s it!
  2. Apply a small amount of this DIY face primer to your face before using makeup. This will help your face to be less oily and help your makeup last longer.

I add a small amount of my regular makeup so that it is tinted a bit. This also helps to keep your make up looking fresh without being overdone.

Another DIY Face Primer recipe

Here is another DIY makeup primer recipe that doesn’t use aloe vera. I realize that some people can’t use it and that in the warmer weather it can be too moist. Aloe Vera is a humectant, pulling moisture out of the air and helping your skin to not dry out as fast. With my skin that is already oily, an alternative homemade face primer was called for.

Ingredients

  • 2 Tablespoons flaxseeds
  • 1/4 cup hot water
  • 1-2 teaspoons arrowroot powder

Instructions

  1. To make this DIY makeup primer, in a small bowl add the flaxseed to the hot water. Stir well and let sit until cool.
  2. Strain the hulls out of the water, which will become a gel at this point.
  3. Depending on how much water you are left with, follow the recipe above, using 1 teaspoon of arrowroot powder to 1 Tablespoon of gel. Mix thoroughly.
  4. This can be used the same way but should be kept in the refrigerator to retard mold and bacteria.

Adding Essential Oils

You can definitely add essential oils to your DIY makeup primer if you’d like.

Add a few drops of lavender or frankincense essential oils to the gel and mix in well. Because essential oils are oils, they may tend to separate out. If this happens, just mix them in again.

Another alternative is to use an infused water when you make the gel. Normally I would use distilled water, but you could also use a strong “tea” made from lavender flowers, calendula petals, or comfrey leaves. Then use this liquid in place of the water for the second recipe.

Save money and control ingredients by making a DIY face makeup primer!

About Debra Maslowski

Debra is a master gardener, a certified herbalist, a natural living instructor and more. She taught Matt and Betsy how to make soap so they decided to bring her on as a staff writer! Debra recently started an organic herb farm in the mountains of Western North Carolina. You can even purchase her handmade products on Amazon! Connect with Debra Maslowski on G+.

PAID ENDORSEMENT DISCLOSURE: In order for us to support our website activities, we may receive monetary compensation or other types of remuneration for our endorsement, recommendation, testimonial and/or link to any products or services from this website.

DISCLAIMER: Information on DIY Natural™ is not reviewed or endorsed by the FDA and is NOT intended to be substituted for the advice of your health care professional. If you rely solely upon this advice you do so at your own risk. Read full Disclaimer & Disclosure statements here.

More Posts You’ll Love

Natural Homemade Baby Wipes For Your Little One

Homemade baby wipes are the sustainable answer to disposable wipes. We use old socks and t-shirts, and the liquid solution is all-natural.

Stop Bleeding Fast with Homemade Styptic Powder

Learn how to stop bleeding with styptic powder, a natural coagulant. It’s easy to make, natural, and the ingredients are common pantry items!

Learn These 5 Ways to Get Rid of Skin Tags Naturally

Learn how to remove skin tags with these 5 strategies to help you get rid of them naturally. They’re not problematic but many want them gone.

Comments

How to make a primerPaula says

Is there a brand of aloe you recommend and/or where to purchase?

How to make a primerMartha says

I don’t have aloe vera gel, but I make my bbn own. Do I have to keep it refrigerated?

How to make a primerCathleen Caffrey says

What is a make-up primer? It might help if your article explained this at the beginning. As someone who almost never wears makeup, I’m puzzled. I occasionally use tinted moisturizer with sunscreen to even out a blotchy skin. And I sometimes use a totally colorless powder if the blotches are especially bad. My skin used to be oily but is now very dry (I’m 74). If there is a better formula for very dry skin, I’d like to know it.

I’ve tried to find Aloe vera gel to make sanitizer but cannot find any that is not mixed with other ingredients. Puzzling because plain aloe used to be widely available. If you can recommend one or two brands, maybe I can find a local store selling one or both.

About Matt & Betsy

How to make a primer

Matt and Betsy are passionate about living naturally and building a like-minded community focused on the sustainable lifestyle.

DIY Natural is about rediscovering the traditional value of doing things yourself, doing them naturally, and enjoying the benefits. Welcome to the movement! (read more)

If you have a question about a topic that is not covered here or in our FAQ , then please contact us.

How can I create a primer?

Paste a Primer Sequence

To create a primer, click Primers → Add Primer. , then copy and paste a sequence.

Select the Binding Site (optional)

How to make a primer

Alternatively, you can begin by selecting the desired binding site on your sequence. If you click the mouse and drag to select, the melting temperature of a corresponding primer will be shown. To add the primer at the selected location, go to Primers → Add Primer.

Specify the Selected Strand (optional)

If the primer will be made from a selected binding site, specify whether the Top Strand or Bottom Strand of the selection should be used.

Name the Primer

If desired, type the primer name.

Edit the Description

If desired, type a description. The Description tab is open by default.

Modify the Primer (optional)

If desired, modify the primer to add a 5’ extension or introduce a mutation. There are two options.

One option is to manually edit the primer sequence in the text box.

How to make a primer

The other option is to click in the primer sequence at the location of the change, and then click the Insertions tab. Use the dialog controls to add a desired codon, restriction site, or peptide coding sequence.

View the Binding Sites and Melting Temperature

The number of binding sites and the calculated melting temperature is shown at the bottom of the window. To see a summary of the melting temperature calculation methods, click the blue text at the lower right corner of the dialog.

View the Primer

How to make a primer

Click Add Primer to Template to see the new primer.

How to make a primer

If you’ve spent a good chunk of your time doing your makeup for that night out with the girls, only to find it smudged and smeared after a few hours, you are making the mistake of not using a primer. No matter how luxurious your foundation and other makeup is, it’s no good without a primer. And if there’s one makeup product every single makeup artist suggests using to help your makeup stay put, it’s this magical product called a primer If you’re new to makeup, let’s begin with the basics and learn how to apply makeup primer the right way.

What Is Makeup Primer?

What is face primer? A primer helps to create an extra layer between your skin and makeup. When you’re spending your time and effort to do your makeup, it’s important to keep it insured, and primer, my friends, is that insurance. Whether you want to smoothen your skin’s surface, even out your skin tone, or cover large pores and fine lines, a primer takes care of all these jobs for you.

Is A Primer Really That Important?

YES! If you’ve seen primers at makeup counters, but never really thought that this extra step makes any difference, then think again. You do need the extra expense of a primer and adding this tiny step to your makeup routine makes a world of a difference. You’ll never fully understand this until you’ve tried it (I was a primer skeptic, but once I gave it a shot, I don’t think I can do without one. Ever.) What attracted me was the fact that it combines the benefits of both cosmetics and skin care. It does indeed, and my skin has never looked or felt healthier. You may wonder, how? The answer lies in its ingredients. No matter what skin struggles you’re experiencing, there’s a primer made for it, and it helps treat them while holding your look together.

How To Apply Makeup Primer?

If you’re willing to incorporate a makeup primer into your makeup routine, I’ll tell you how to use face primer to make the most of it. But before that, here are some great primers that you can try –

Benefit POREfessional Face Primer, Smashbox Photo Finish Foundation Primer, Maybelline Baby Skin Instant Pore Eraser, e.l.f Cosmetics Blemish Control Primer.

How To Apply Primer – A Step-By-Step Tutorial With Pictures

Follow these simple steps to learn how to apply makeup primer and help your makeup last all day long.

What You Need
  1. A primer
  2. Clean fingertips

1. Prep Your Skin

How to make a primer

This step is crucial if you want your makeup to look flawless. Use a gentle cleanser to wash your face, exfoliate and apply a lightweight moisturizer before anything else. Let it sink into your skin.

2. Applying Primer

How to make a primer

How to apply foundation primer to even out Take a small amount of your primer at the back of your hand, and simply apply it with your fingertips, blending from the nose outwards. Once it’s fully blended, your skin will look more even-toned and luminous, and your foundation will sit better. Wait a few minutes after application, before you go in with your foundation, to allow the primer to sink in and create a smooth surface. You can also use the primer alone without any foundation if you want to keep it simple.

This is how your skin will look after application. You’ll see that the appearance of your pores and fine lines has visibly reduced. Also, it helps tackle redness and smoothen out the texture of your skin.

How to make a primer

Tips: Making The Best Of Your Primer

If you’ve come this far, I’m sure you’re keen on actually trying out a primer now. Here are a bunch of tips and tricks that will come in handy when you’re applying your primer.

  • When it comes to primer, less is more. A small raisin-sized drop will suffice. Rub this into the skin well for even coverage.
  • Always apply moisturizer BEFORE you apply the primer.
  • If your skin is dull, try a tinted primer to help add some glow and life back into your skin.
  • Always make sure your primer is compatible with your foundation. You want to use water-based primers with water-based foundation, and silicone-based primers with the same foundations. This will prevent your base from separating.
  • Apply primer around the eyes and on the lids as well. This helps prevent makeup from smudging or creasing by absorbing oils. It also softens crow’s feet.

How To Choose A Primer For My Skin Type?

Make sure you understand your skin type before heading out to buy a primer because you don’t want to pick out the wrong one for your skin. Here’s how you can do that.

  • If you have dry or flaky skin, choose a hydrating primer. Look for words like “soothing,” “hydrating,” and “replenishing.”
  • If your skin is oily, use a mattifying primer to reduce your skin’s oil production and minimize shine.
  • If you have acne-prone or very sensitive skin, opt for water-based primers because silicone-based ones may clog pores and cause breakouts or irritation.
  • Use a primer with nourishing ingredients and one that’s infused with antioxidants for mature or aging skin.

It’s also a great idea to try before you buy! If you walk into Sephora, you can pick up a few samples of the primers you’re interested in. A little trial and error is necessary to find your best pick. That was all about the benefits of primer and how to use makeup primer. Do you have a go-to primer or tricks to help your makeup stay in place for longer? Let us know in the comments section below.

Frequently Asked Questions

How long will the makeup last if I use a primer?

A good primer will lock your foundation in place and extend its staying power by 8 hours or more. Some long staying primers promise an impressive 15 hours of makeup wear.

Should I apply primer before or after moisturizer?

Always apply your primer after you moisturize your face. It will create a barrier between your hydrated skin and your foundation.

Is it better to use a primer without silicone?

Silicone-based primers help blur out the appearance of large pores and fine lines more effectively. But if you have acne-prone or sensitive skin, it’s better to steer clear of a primer with silicone and opt for water-based options.

Are there separate primers available for eyes and lips?

Yes. An eyelid primer generally has a thicker consistency than a face primer. These help products apply more vividly and prevent eyeshadow fallout. You can try the Benefit Stay Don’t Stray eye primer. A lip primer ensures smoother and even application of your lip color and prevents the color from bleeding out. Try the Becca Lip Priming Perfector.

It would be too costly for me to have primer sent from the US to Japan. The military bases do not sell paint or primer (hazmat issues). Benjamin Moore Japan primer is way beyond my price range and the Japanese normally don’t use primer (they use wallpaper or cloth to cover drywall). Someone told me that if I mix about 1 cup of plaster in a gallon of water base paint it will be just as good as any primer on the market. Is this true? What do you think?

I never heard of mixing plaster with paint but I have mixed drywall mud with paint without any problems, don’t mix in too much. You can also just use a good flat acrylic paint for priming drywall and drywall mud. This will work as a primer for plaster after a 30 day cure time. This isn’t as good as a good PVA primer but works in a pinch. Also any exterior acrylic primer will work.

After submitting the question I realized that plaster is the incorrect term. What I should have typed was drywall joint compound (mud).

I have two types of mud a base coat which is a heavier grit and a finish (top coat), which is a much finer grit. I also have a 20 kilo bag of gypsum used to mark the white lines on a baseball or football field.

Is the drywall compound you have a powder or thick ‘mud’? Either way might not matter but the best to use for your purpose is regular all purpose joint compound, not the fast drying setting type. Don’t use the marking powder.

I have made texture paint by adding all purpose compound to acrylic primers and don’t think it will hurt a good paint. The biggest consideration is how much to add. For a regular interior flat paint I would add no more that 1/4 by volume. Sheened paints, satin, can have a little more. The problem is when the paint/mud mixture dries the mud part wants to shrink and get hard. This will cause the paint to crack if there is too much mud added. Although this could be a neat look, you need to experiment to find the right ratio.

For your purpose you don’t need to add much. As stated earlier, my answer, to just prime the surface use a good flat paint. To add a little texture and get a very even finish adding the joint compound is a good idea. It will give an even seal and look to a smooth wall. This is exactly like using USG First Coat, a product used by drywallers to produce a very even smooth wall.

Another consideration is application. If rolling you need to use a good back rolling technique. Use a 3/8 roller cover, lambs wool is best but any good cover will work. Normally you would go up-down-up-down with the roller. With this mixture this will leave visible lines as the texture produced will be up-down-up-down. You need to quickly roll a narrow section, top to bottom, then go back and roll from the top down only. This will lay the roller texture in the same direction.

Primer Design for PCR

Oligonucleotide primers are necessary when running a PCR reaction. One needs to design primers that are complementary to the template region of DNA. They are synthesized chemically by joining nucleotides together. One must selectively block and unblock repeatedly the reactive groups on a nucleotide when adding a nucleotide one at a time. The main property of primers is that they must correspond to sequences on the template molecule (must be complementary to template strand). However, primers do not need to correspond to the template strand completely; it is essential, however, that the 3’ end of the primer corresponds completely to the template DNA strand so elongation can proceed. Usually a guanine or cytosine is used at the 3’ end, and the 5’ end of the primer usually has stretches of several nucleotides. Also, both of the 3’ ends of the hybridized primers must point toward one another.

The size of the primer is very important as well. Short primers are mainly used for amplifying a small, simple fragment of DNA. On the other hand, a long primer is used to amplify a eukaryotic genomic DNA sample. However, a primer should not be too long (> 30-mer primers) or too short. Short primers produce inaccurate, nonspecific DNA amplification product, and long primers result in a slower hybridizing rate. On average, the DNA fragment that needs to be amplified should be within 1-10 kB in size.

The structure of the primer should be relatively simple and contain no internal secondary structure to avoid internal folding. One also needs to avoid primer-primer annealing which creates primer dimers and disrupts the amplification process. When designing, if unsure about what nucleotide to put at a certain position within the primer, one can include more than one nucleotide at that position termed a mixed site. One can also use a nucleotide-based molecular insert (inosine) instead of a regular nucleotide for broader pairing capabilities.

Taking into consideration the information above, primers should generally have the following properties:

  • Length of 18-24 bases
  • 40-60% G/C content
  • Start and end with 1-2 G/C pairs
  • Melting temperature (Tm) of 50-60°C
  • Primer pairs should have a Tm within 5°C of each other

Primer pairs should not have complementary regions

Note: If you will be including a restriction site at the 5’ end of your primer, note that a 3-6 base pair “clamp” should be added upstream in order for the enzyme to cleave efficiently (e.g. GCGGCG-restriction site-your sequence).

How to make a primer

Protocol Video

Watch the protocol video below to learn how to design primers for PCR.

Ramblings on explosives, guns, politics, and sex by a redneck Idaho farm boy who became a software engineer living near Seattle.

How to make a primer

This is the description of the document and author:

This document describes how to make homemade ammunition primers. Approaches to make corrosive and noncorrosive primers are covered.

W. Marshall Thompson PhD

Revision Date: June 28, 2019

I found it fascinating reading. It starts with how primers work and the history of primers, then tells how to make primers that are extremely simple and safe to make but are somewhat less reliable and powerful than commercial grade primers, and concludes with how to make commercial grade primers and even “green” (lead free) state of the art primers. It’s amazing!

Like this:

Related

8 thoughts on “ How to make your own primers ”

Nice. I’m part way through it. There’s a lot of excellent detail there.

Curious that primer manufacturing still involves some manual labor. It would make so much sense to do it all by machine.

I wonder if there are analogous guides for the making of smokeless powder.

Nitric acid- with small amounts of sulfuric acid. On purified cotton for about 24 hrs., under temperature control. Yields nitro-cellulous. or a simple form of gun-cotton. For years the size of the grain controls the burn rate. From flaky Bullseye,(fast).To large grains for 7828,(slow). These days they have certain “fire dampeners”, chemically infused into the grain to control the burn speed. Or something like calcium carbonate on the outside.
I wouldn’t try it at home.
This comment is for information only. Seriously.
Thanks Rolf and Joe!

Yes, I remember that procedure. And I know there are various recipes for turning the fibrous nitrocellulose into a more gel-like substance.
I’ve been imagining making the raw material, then running it through a pasta maker. Home made cordite, yeah…

BTW, speaking of grain size: I once read that cordite is made in several sizes, with the larger ones (ziti-shaped?) for use in artillery where you want extra slow burn for the extra long barrels.

I knew about the primer caps, but not the others. Nice info and the detailed how-to is good.

While reading it, I had a thought. I actually HAVE been saving my used primers while reloading, mostly waiting until I have an entire powder-bottle entirely full of them. But I have not been separating them between large and small, rifle and pistol. Separating based on size would be tedious but simple. Separating rifle from pistol would be, well, it is mostly pistol, I know, but…… not so sure. Hopefully I never have to do so, I can just buy more.

Right? Downloaded a copy just for the Info.

I don’t believe I’ll ever use it, but hey – Knowledge is power.

One of the primer compounds is described as containing “powdered nitrocellulose” and the author comments that this is strange because smokeless gunpowder is a rubbery or paste-like consistency that doesn’t like to be ground into a powder.
That’s true given the plasticizers that are part of the ingredients, but is it true for plain nitrocellulose? I thought it isn’t. I wonder if that’s what was intended and he missed that possibility — and perhaps ended up with a preparation that exhibits surprising partial burning because of it.
I’d send him a note but I don’t know any contact information.

Don’t miss out on this game-changing step.

How to make a primer

There’s nothing more annoying than applying touch-ups all day because your face makeup is disappearing faster than Houdini. Such a waste of time! “A lot of people think primers are just an extra step in a routine, but makeup primers are actually a must-have if you want your foundation to last,” says Sona Gasparian, makeup artist and founder of Pérsona Cosmetics. You’re giving your foundation something to latch onto, she explains—and a good primer can even skin tone, camouflage pores, and help your makeup withstand the test of a sweaty commute or late night.

But here’s the thing: All face primers are not created equal. Think of priming as the last step in your skincare routine rather than the first step in your makeup application. Meaning, you should pay attention to your skin concerns when picking the right formula for you, just as you would when thinking about skincare. The best makeup primers are packed with good-for-your-skin ingredients, like hyaluronic acid, vitamins, and oils. They should also offer complexion benefits, like smoothing, hydrating, and brightening—just like your other skincare products.

Before you use a primer, you should start with freshly cleansed skin, says Gasparian. Apply your toners, serums, moisturizers, whatever, like you normally would—then give all of your skincare products a minute to dry before you go in with primer. Gasparian recommends starting with a pea-sized amount of primer and working it in with your fingers. Then you can apply the rest of your makeup. Ready to slay all day? Try these makeup artist-approved face primers:

How to make a primer

“This moisturizer and face primer in one absorbs quickly into the skin and looks great under almost every foundation,” says makeup artist Gisela Fernandez. “Niacinamide plumps the skin while hyaluronic acid delivers long-lasting hydration. This amazing product prevents foundation from settling into fine lines, dry patches, and pores.”

How to make a primer

This tan lotion has a ton of light-reflecting mica particles, giving you a radiant complexion the second you swipe it on. It also has slight blurring properties, so you can use it alone if you prefer a no-makeup makeup look, too.

How to make a primer

“I love the Becca Priming Filter,” says makeup artist Tobi Henney. “It gives my clients the most gorgeous glow to their skin.” This priming lotion is packed with light-reflecting particles that make your skin glow—but is completely formulated without skin-irritating parabens, pthalates, and sulfates.

How to make a primer

It primes your skin, it sets your makeup, and it refreshes your look throughout the day. Is there anything this spray can’t do? Before use, just make sure you give it a good shake to incorporate the tiny shimmer flakes into the hydrating base.

How to make a primer

“For my oily skin, I love using this primer from Benefit because I can actually see my pores disappearing as I’m applying it,” says makeup artist Anum Siraj. “It’s also extremely lightweight, so I don’t feel any extra heaviness on my face before adding my foundation.” It also helps you look matte (not greasy) all day long.

How to make a primer

Get an Instagram filter look IRL with this blurring and moisturizing face primer. The blend if silicones even out the surface of your skin without adding any coverage, and the coconut-derived hydrators keep your skin supple.

How to make a primer

“I have dry, acne-prone skin and rely on primer to give me an even base and to mattify my larger pores,” says Gasparian. “This moisture-rich primer is great for dry skin because it hydrates, brightens, and provides a dewy-looking finish.”

How to make a primer

If you’re dealing with a ruddy complexion, you know that the redness can easily seep through your foundation, especially if you prefer something with light to medium coverage. Instead, start with this green-tinted primer to color-correct your redness before you go in with your base of choice (I promise it won’t make you look green!).

How to make a primer

“I’m currently obsessed with the Hourglass Veil Mineral Primer,” says Maddie North, a celebrity makeup artist. “You only have to use a tiny amount, and it feels like velvet, which all of my clients love—no one wants to feel like their makeup is caked on.” The mineral formula is lightweight and oil-free, keeping combo skin types happy.

How to make a primer

As far as the green beauty market has come, it can still be tricky to find all-natural primers. This brightening version from Ilia is so good (it smoothes, moisturizes, and adds radiance), you won’t even know it free of silicone,